Jump to content
Taki

"Hello World!" dans tous les langages

Recommended Posts

En xul :

<?xml version="1.0" encoding="ISO-8859-1"?>
<?xml-stylesheet href="mycss.css" type="text/css"?>
<window xmlns="http://www.mozilla.org/keymaster/gatekeeper/there.is.only.xul">
<description>Hello World</description>
</window>

En wml

<?xml version="1.0"?>
<!DOCTYPE wml PUBLIC "-//WAPFORUM//DTD WML 1.1//EN" "http://www.wapforum.org/DTD/wml_1.1.xml">
<wml>
<card id="card1" title="Hello" >
<p>Hello World</p>
</card>
</wml>

Share this post


Link to post
Share on other sites

de 4 manières en SSPL


Hello World !

§Hello World !

$r.null Hello World !

$0 Hello World !

(respectivement : en texte normal, en titre, en tag d'histogramme, en tag de nombre)

note:

le Simple Statistics Presentation Language est mon invention de ce soir même.

Je viens de finir une première implémentation qui marche pas mal.

Je l'ai crée pour simplifier la saisie d'un template en vue d'une étude de dénombrement.

Plus de détails ici

Share this post


Link to post
Share on other sites

En RPL (normal), HP48GX (façon boite):

<< CLLDC "Hello World!" MSGBOX 0 FREEZE >>

Vais voir à le faire en RPL-system plus tard

Share this post


Link to post
Share on other sites

allez c'est pas un hello world mais c'est un 'hi' qui a le merite d'etre polyglote

#define print(x) main(){printf(x);return 0;} /* >+++++[<++>-]<[>++++
# +++<-]>++.+.[-]>+++++[<++>-]<.[-][
#
# This polyglot prints "HI" when run in
# Brainfuck, C, COW, Perl, Python, Gammaplex, l33t, and ruby
# 
# */
print ("HI\n")
#/* 
# @X"H"Xr X"I"Xr RE 
# moOMoOMoOMoOMoOMoOMOOmOoMoOMoOmoOMOomoo 
# mOoMOOmoOMoOMoOMoOMoOMoOMoOMoOmOoMOomoo 
# moOMoOMoOMooMoOMooMOOMOomoomoOMoOMoOMoO 
# MoOMoOMOOmOoMoOMoOmoOMOomoomOoMooMOOMOo 
# moo 5 0 7 99999998 1 7 0 1 8 9999998 1 91 
# ] */

© Marinus Oosters

Share this post


Link to post
Share on other sites

CAML

let = print_endline "Hello world !";;

Je vais me permettre une petite correction étant donné que je suis un pro de CAML.

Ce n'est pas la bonne syntaxe. Pour preuve, la réponse de CAML est :

# let = print_endline "Hello world !";;

Characters 4-5:

let = print_endline "Hello world !";;

^

Syntax error

La bonne syntaxe serait :

print_endline "Hello World !" ;;

Share this post


Link to post
Share on other sites

allez c'est pas un hello world mais c'est un 'hi' qui a le merite d'etre polyglote

#define print(x) main(){printf(x);return 0;} /* >+++++[<++>-]<[>++++
# +++<-]>++.+.[-]>+++++[<++>-]<.[-][
#
# This polyglot prints "HI" when run in
# Brainfuck, C, COW, Perl, Python, Gammaplex, l33t, and ruby
# 
# */
print ("HI\n")
#/* 
# @X"H"Xr X"I"Xr RE 
# moOMoOMoOMoOMoOMoOMOOmOoMoOMoOmoOMOomoo 
# mOoMOOmoOMoOMoOMoOMoOMoOMoOMoOmOoMOomoo 
# moOMoOMoOMooMoOMooMOOMOomoomoOMoOMoOMoO 
# MoOMoOMOOmOoMoOMoOmoOMOomoomOoMooMOOMOo 
# moo 5 0 7 99999998 1 7 0 1 8 9999998 1 91 
# ] */

© Marinus Oosters

Magnifique !

Share this post


Link to post
Share on other sites

Brainfuck

++++++++++
[
  >+++++++>++++++++++>+++>+<<<<-
]
>++.
>+.
+++++++.
.
+++.
>++.
<<+++++++++++++++.
>.
+++.
------.
--------.
>+.
>.

Share this post


Link to post
Share on other sites

vous avez oublié le français

-----------------------

dire => " bonjour tout le monde "

-----------------------

:chinois:

Share this post


Link to post
Share on other sites
Chui pas bien sûr que tu ai saisi le but du topic.

ASP

<html>
<head>
<title>Hello World</title>
</head>
<body>
<%
response.write("Hello World!")
%>
</body>
<html>

XML

Code de hello.xml

<?xml version="1.0" encoding="ISO-8859-1"?>
<?xml-stylesheet type="text/xsl" href="hello.xsl" ?>

<hello>
Hello World!
</hello>

Code de hello.xsl

<?xml version="1.0" encoding="ISO-8859-1"?>
<xsl:stylesheet version="1.0" xmlns:xsl="http://www.w3.org/1999/XSL/Transform">
<xsl:template match="/">
	<HTML>
	<HEAD>
	  <TITLE>Hello World</TITLE>
	</HEAD>

	<BODY>
	<xsl:apply-templates/>
	</BODY>
	</HTML>

</xsl:template >



<xsl:template match="hello" >
		<p>
				<xsl:value-of select="."/>
		</p>
</xsl:template >

</xsl:stylesheet>

C'est mieux comme ça? :yes:

Share this post


Link to post
Share on other sites

En texas instrument TI-83+ :

Disp "Hello world !"

Et pour poursuivre dans les calculettes, avec une sharp EL-9400 :

Print "Hello world !"

Share this post


Link to post
Share on other sites

Chalut

en javascript + HTML

<html>
<body>
<script language="javascript">
document.write("Hello World");
</script>
</body>
</html>

on peut aussi faire comme ça

<html>
<head>
<script language="javascript">
function bijour(){
document.write("Hello World");}
</script>
</head>
<body onLoad="bijour()">
</body>
</html>

Avec Nsis (Installateur de Winamp)

Name "Bonjour"
OutFile "bonjour.exe"
AutoCloseWindow true

Section ""
MessageBox MB_OK "Hello World"
SectionEnd

Petite variation

Name "Bonjour"
OutFile "bonjour2.exe"
AutoCloseWindow true

Section ""
MessageBox MB_OK "Salut PcInpact et vive les poussins !!"
SectionEnd

Function .onInit
MessageBox MB_OK "Hello World"
FunctionEnd

@pluche

Edited by Pattenrond

Share this post


Link to post
Share on other sites

Je doute que personne ne l'ai encore faite celle là.

tu parles de quoi ?

Le batch, j'en ai vu une variante.

Le nsis, j'en ai pas vu

le javascript, euh, j'en ai pas vu (enfin je crois)

Share this post


Link to post
Share on other sites

En C:

	int n[]={0x48,
0x65,0x6C,0x6C,
0x6F,0x2C,0x20,
0x77,0x6F,0x72,
0x6C,0x64,0x21,
0x0A,0x00},*m=n;
main(n){putchar
(*m)!='\0'?main
(m++):exit(n++);}

Et sinon....

Liste des hello world: http://en.wikipedia.org/wiki/List_of_hello_world_programs

Liste des hello world en langages ésoteriques: http://en.wikipedia.org/wiki/Hello_world_p...teric_languages

Dont mon préféré est le HQ9+:

H

Share this post


Link to post
Share on other sites

Pour l'ancien scientifique que je suis, je trouve le DNA / Genetic code sympa :arrow:

It is possible to treat the standard genetic code as a programming language; the following translates to the peptide HELLQWQRLD.

TACGTACTTAATAATGTTACCGTTGCAAATCTAATC

Share this post


Link to post
Share on other sites
TACGTACTTAATAATGTTACCGTTGCAAATCTAATC

D'accord mais est ce qu'elle existe dans la nature?

De toutes façons, comme disais je ne sais plus qui, quand on aura décrypté tout le génome humain on se rendra compte que les derniers 5% sont les mentions légales et le copyright ^^;

(je crois que ça à été décrypté entierement mais bon. c'etait quand même drole)

Share this post


Link to post
Share on other sites

Please sign in to comment

You will be able to leave a comment after signing in



Sign In Now

×
×
  • Create New...