Jump to content
View in the app

A better way to browse. Learn more.

Next

A full-screen app on your home screen with push notifications, badges and more.

To install this app on iOS and iPadOS
  1. Tap the Share icon in Safari
  2. Scroll the menu and tap Add to Home Screen.
  3. Tap Add in the top-right corner.
To install this app on Android
  1. Tap the 3-dot menu (⋮) in the top-right corner of the browser.
  2. Tap Add to Home screen or Install app.
  3. Confirm by tapping Install.

Featured Replies

  • Replies 209
  • Views 214.4k
  • Created
  • Last Reply

Top Posters In This Topic

En xul :

<?xml version="1.0" encoding="ISO-8859-1"?>
<?xml-stylesheet href="mycss.css" type="text/css"?>
<window xmlns="http://www.mozilla.org/keymaster/gatekeeper/there.is.only.xul">
<description>Hello World</description>
</window>

En wml

<?xml version="1.0"?>
<!DOCTYPE wml PUBLIC "-//WAPFORUM//DTD WML 1.1//EN" "http://www.wapforum.org/DTD/wml_1.1.xml">
<wml>
<card id="card1" title="Hello" >
<p>Hello World</p>
</card>
</wml>

de 4 manières en SSPL


Hello World !

§Hello World !

$r.null Hello World !

$0 Hello World !

(respectivement : en texte normal, en titre, en tag d'histogramme, en tag de nombre)

note:

le Simple Statistics Presentation Language est mon invention de ce soir même.

Je viens de finir une première implémentation qui marche pas mal.

Je l'ai crée pour simplifier la saisie d'un template en vue d'une étude de dénombrement.

Plus de détails ici

  • 3 weeks later...

En RPL (normal), HP48GX (façon boite):

<< CLLDC "Hello World!" MSGBOX 0 FREEZE >>

Vais voir à le faire en RPL-system plus tard

  • 11 months later...

allez c'est pas un hello world mais c'est un 'hi' qui a le merite d'etre polyglote

#define print(x) main(){printf(x);return 0;} /* >+++++[<++>-]<[>++++
# +++<-]>++.+.[-]>+++++[<++>-]<.[-][
#
# This polyglot prints "HI" when run in
# Brainfuck, C, COW, Perl, Python, Gammaplex, l33t, and ruby
# 
# */
print ("HI\n")
#/* 
# @X"H"Xr X"I"Xr RE 
# moOMoOMoOMoOMoOMoOMOOmOoMoOMoOmoOMOomoo 
# mOoMOOmoOMoOMoOMoOMoOMoOMoOMoOmOoMOomoo 
# moOMoOMoOMooMoOMooMOOMOomoomoOMoOMoOMoO 
# MoOMoOMOOmOoMoOMoOmoOMOomoomOoMooMOOMOo 
# moo 5 0 7 99999998 1 7 0 1 8 9999998 1 91 
# ] */

© Marinus Oosters

CAML

let = print_endline "Hello world !";;

Je vais me permettre une petite correction étant donné que je suis un pro de CAML.

Ce n'est pas la bonne syntaxe. Pour preuve, la réponse de CAML est :

# let = print_endline "Hello world !";;

Characters 4-5:

let = print_endline "Hello world !";;

^

Syntax error

La bonne syntaxe serait :

print_endline "Hello World !" ;;

allez c'est pas un hello world mais c'est un 'hi' qui a le merite d'etre polyglote

#define print(x) main(){printf(x);return 0;} /* >+++++[<++>-]<[>++++
# +++<-]>++.+.[-]>+++++[<++>-]<.[-][
#
# This polyglot prints "HI" when run in
# Brainfuck, C, COW, Perl, Python, Gammaplex, l33t, and ruby
# 
# */
print ("HI\n")
#/* 
# @X"H"Xr X"I"Xr RE 
# moOMoOMoOMoOMoOMoOMOOmOoMoOMoOmoOMOomoo 
# mOoMOOmoOMoOMoOMoOMoOMoOMoOMoOmOoMOomoo 
# moOMoOMoOMooMoOMooMOOMOomoomoOMoOMoOMoO 
# MoOMoOMOOmOoMoOMoOmoOMOomoomOoMooMOOMOo 
# moo 5 0 7 99999998 1 7 0 1 8 9999998 1 91 
# ] */

© Marinus Oosters

Magnifique !

  • 2 months later...

Brainfuck

++++++++++
[
  >+++++++>++++++++++>+++>+<<<<-
]
>++.
>+.
+++++++.
.
+++.
>++.
<<+++++++++++++++.
>.
+++.
------.
--------.
>+.
>.

vous avez oublié le français

-----------------------

dire => " bonjour tout le monde "

-----------------------

:chinois:

  • 5 months later...
Chui pas bien sûr que tu ai saisi le but du topic.

ASP

<html>
<head>
<title>Hello World</title>
</head>
<body>
<%
response.write("Hello World!")
%>
</body>
<html>

XML

Code de hello.xml

<?xml version="1.0" encoding="ISO-8859-1"?>
<?xml-stylesheet type="text/xsl" href="hello.xsl" ?>

<hello>
Hello World!
</hello>

Code de hello.xsl

<?xml version="1.0" encoding="ISO-8859-1"?>
<xsl:stylesheet version="1.0" xmlns:xsl="http://www.w3.org/1999/XSL/Transform">
<xsl:template match="/">
	<HTML>
	<HEAD>
	  <TITLE>Hello World</TITLE>
	</HEAD>

	<BODY>
	<xsl:apply-templates/>
	</BODY>
	</HTML>

</xsl:template >



<xsl:template match="hello" >
		<p>
				<xsl:value-of select="."/>
		</p>
</xsl:template >

</xsl:stylesheet>

C'est mieux comme ça? :yes:

  • 2 weeks later...
  • 2 weeks later...
  • 2 weeks later...

En texas instrument TI-83+ :

Disp "Hello world !"

Et pour poursuivre dans les calculettes, avec une sharp EL-9400 :

Print "Hello world !"

Chalut

en javascript + HTML

<html>
<body>
<script language="javascript">
document.write("Hello World");
</script>
</body>
</html>

on peut aussi faire comme ça

<html>
<head>
<script language="javascript">
function bijour(){
document.write("Hello World");}
</script>
</head>
<body onLoad="bijour()">
</body>
</html>

Avec Nsis (Installateur de Winamp)

Name "Bonjour"
OutFile "bonjour.exe"
AutoCloseWindow true

Section ""
MessageBox MB_OK "Hello World"
SectionEnd

Petite variation

Name "Bonjour"
OutFile "bonjour2.exe"
AutoCloseWindow true

Section ""
MessageBox MB_OK "Salut PcInpact et vive les poussins !!"
SectionEnd

Function .onInit
MessageBox MB_OK "Hello World"
FunctionEnd

@pluche

Edited by Pattenrond

Je doute que personne ne l'ai encore faite celle là.

tu parles de quoi ?

Le batch, j'en ai vu une variante.

Le nsis, j'en ai pas vu

le javascript, euh, j'en ai pas vu (enfin je crois)

Pour l'ancien scientifique que je suis, je trouve le DNA / Genetic code sympa :arrow:

It is possible to treat the standard genetic code as a programming language; the following translates to the peptide HELLQWQRLD.

TACGTACTTAATAATGTTACCGTTGCAAATCTAATC

  • 2 weeks later...
TACGTACTTAATAATGTTACCGTTGCAAATCTAATC

D'accord mais est ce qu'elle existe dans la nature?

De toutes façons, comme disais je ne sais plus qui, quand on aura décrypté tout le génome humain on se rendra compte que les derniers 5% sont les mentions légales et le copyright ^^;

(je crois que ça à été décrypté entierement mais bon. c'etait quand même drole)

Join the conversation

You can post now and register later. If you have an account, sign in now to post with your account.

Guest
Reply to this topic...

Configure browser push notifications

Chrome (Android)
  1. Tap the lock icon next to the address bar.
  2. Tap Permissions → Notifications.
  3. Adjust your preference.
Chrome (Desktop)
  1. Click the padlock icon in the address bar.
  2. Select Site settings.
  3. Find Notifications and adjust your preference.