"Hello World!" dans tous les langages

flopasques · November 9, 2004

En Visual J# [J Sharp]

MessageBox.Show("Hello World !");

En Visual FoxPro

MESSAGEBOX("Hello World !","Hello",36,1)

an0nyme · November 13, 2004

En xul :

<?xml version="1.0" encoding="ISO-8859-1"?>
<?xml-stylesheet href="mycss.css" type="text/css"?>
<window xmlns="http://www.mozilla.org/keymaster/gatekeeper/there.is.only.xul">
<description>Hello World</description>
</window>

En wml

<?xml version="1.0"?>
<!DOCTYPE wml PUBLIC "-//WAPFORUM//DTD WML 1.1//EN" "http://www.wapforum.org/DTD/wml_1.1.xml">
<wml>
<card id="card1" title="Hello" >
<p>Hello World</p>
</card>
</wml>

namewithn0man · November 14, 2004

de 4 manières en SSPL


Hello World !

§Hello World !

$r.null Hello World !

$0 Hello World !

(respectivement : en texte normal, en titre, en tag d'histogramme, en tag de nombre)

note:

le Simple Statistics Presentation Language est mon invention de ce soir même.

Je viens de finir une première implémentation qui marche pas mal.

Je l'ai crée pour simplifier la saisie d'un template en vue d'une étude de dénombrement.

Plus de détails ici

Arofarn · November 29, 2004

En RPL (normal), HP48GX (façon boite):

<< CLLDC "Hello World!" MSGBOX 0 FREEZE >>

Vais voir à le faire en RPL-system plus tard

Wooden · October 31, 2005

allez c'est pas un hello world mais c'est un 'hi' qui a le merite d'etre polyglote

#define print(x) main(){printf(x);return 0;} /* >+++++[<++>-]<[>++++
# +++<-]>++.+.[-]>+++++[<++>-]<.[-][
#
# This polyglot prints "HI" when run in
# Brainfuck, C, COW, Perl, Python, Gammaplex, l33t, and ruby
# 
# */
print ("HI\n")
#/* 
# @X"H"Xr X"I"Xr RE 
# moOMoOMoOMoOMoOMoOMOOmOoMoOMoOmoOMOomoo 
# mOoMOOmoOMoOMoOMoOMoOMoOMoOMoOmOoMOomoo 
# moOMoOMoOMooMoOMooMOOMOomoomoOMoOMoOMoO 
# MoOMoOMOOmOoMoOMoOmoOMOomoomOoMooMOOMOo 
# moo 5 0 7 99999998 1 7 0 1 8 9999998 1 91 
# ] */

SooW · October 31, 2005

CAML

let = print_endline "Hello world !";;

Je vais me permettre une petite correction étant donné que je suis un pro de CAML.

Ce n'est pas la bonne syntaxe. Pour preuve, la réponse de CAML est :

# let = print_endline "Hello world !";;
Characters 4-5:

let = print_endline "Hello world !";;

^

Syntax error

La bonne syntaxe serait :

print_endline "Hello World !" ;;

neves · October 31, 2005

allez c'est pas un hello world mais c'est un 'hi' qui a le merite d'etre polyglote

#define print(x) main(){printf(x);return 0;} /* >+++++[<++>-]<[>++++
# +++<-]>++.+.[-]>+++++[<++>-]<.[-][
#
# This polyglot prints "HI" when run in
# Brainfuck, C, COW, Perl, Python, Gammaplex, l33t, and ruby
# 
# */
print ("HI\n")
#/* 
# @X"H"Xr X"I"Xr RE 
# moOMoOMoOMoOMoOMoOMOOmOoMoOMoOmoOMOomoo 
# mOoMOOmoOMoOMoOMoOMoOMoOMoOMoOmOoMOomoo 
# moOMoOMoOMooMoOMooMOOMOomoomoOMoOMoOMoO 
# MoOMoOMOOmOoMoOMoOmoOMOomoomOoMooMOOMOo 
# moo 5 0 7 99999998 1 7 0 1 8 9999998 1 91 
# ] */

Magnifique !

kmlz · January 3, 2006

Brainfuck

++++++++++
[
  >+++++++>++++++++++>+++>+<<<<-
]
>++.
>+.
+++++++.
.
+++.
>++.
<<+++++++++++++++.
>.
+++.
------.
--------.
>+.
>.

Eagle1 · January 3, 2006

vous avez oublié le français

-----------------------

dire => " bonjour tout le monde "

-----------------------

:chinois:

tsubasaleguedin · June 12, 2006

En C.A. Clipper/xBase

?"Hello World"

ou

@SAY 1,1 "Hello World"

En xHarbour

qout("Hello world")

Shinuza · June 16, 2006

XML + XSL ainsi que ASP

theocrite · June 17, 2006

Chui pas bien sûr que tu ai saisi le but du topic.

Shinuza · June 18, 2006

Chui pas bien sûr que tu ai saisi le but du topic.

ASP

<html>
<head>
<title>Hello World</title>
</head>
<body>
<%
response.write("Hello World!")
%>
</body>
<html>

XML

Code de hello.xml

<?xml version="1.0" encoding="ISO-8859-1"?>
<?xml-stylesheet type="text/xsl" href="hello.xsl" ?>

<hello>
Hello World!
</hello>

Code de hello.xsl

<?xml version="1.0" encoding="ISO-8859-1"?>
<xsl:stylesheet version="1.0" xmlns:xsl="http://www.w3.org/1999/XSL/Transform">
<xsl:template match="/">
	<HTML>
	<HEAD>
	  <TITLE>Hello World</TITLE>
	</HEAD>

	<BODY>
	<xsl:apply-templates/>
	</BODY>
	</HTML>

</xsl:template >



<xsl:template match="hello" >
		<p>
				<xsl:value-of select="."/>
		</p>
</xsl:template >

</xsl:stylesheet>

C'est mieux comme ça? :yes:

mikemowgli · July 1, 2006

il manque le shell de linux/unix non?

echo Hello World!

tout simplement :yes:

Sentinel · July 1, 2006

en rot180 :

plrom ollay

(private joke irc inside :yes: )

tsubasaleguedin · July 13, 2006

en rot180 :

plrom ollay

(private joke irc inside )

C'est pas un cryptage plutot le rot ?

theocrite · July 13, 2006

s/cryptage/chiffrement/

marque-page · July 26, 2006

En texas instrument TI-83+ :

Disp "Hello world !"

Et pour poursuivre dans les calculettes, avec une sharp EL-9400 :

Print "Hello world !"

Pattenrond · July 29, 2006

Chalut

en javascript + HTML

<html>
<body>
<script language="javascript">
document.write("Hello World");
</script>
</body>
</html>

on peut aussi faire comme ça

<html>
<head>
<script language="javascript">
function bijour(){
document.write("Hello World");}
</script>
</head>
<body onLoad="bijour()">
</body>
</html>

Avec Nsis (Installateur de Winamp)

Name "Bonjour"
OutFile "bonjour.exe"
AutoCloseWindow true

Section ""
MessageBox MB_OK "Hello World"
SectionEnd

Petite variation

Name "Bonjour"
OutFile "bonjour2.exe"
AutoCloseWindow true

Section ""
MessageBox MB_OK "Salut PcInpact et vive les poussins !!"
SectionEnd

Function .onInit
MessageBox MB_OK "Hello World"
FunctionEnd

@pluche

Edited July 29, 2006 by Pattenrond

Pattenrond · July 29, 2006

J'ai ça aussi

Le batch

@echo off
echo Hello World

theocrite · August 2, 2006

Je doute que personne ne l'ai encore faite celle là.

Pattenrond · August 2, 2006

Je doute que personne ne l'ai encore faite celle là.

tu parles de quoi ?

Le batch, j'en ai vu une variante.

Le nsis, j'en ai pas vu

le javascript, euh, j'en ai pas vu (enfin je crois)

FiP_ · August 2, 2006

En C:

	int n[]={0x48,
0x65,0x6C,0x6C,
0x6F,0x2C,0x20,
0x77,0x6F,0x72,
0x6C,0x64,0x21,
0x0A,0x00},*m=n;
main(n){putchar
(*m)!='\0'?main
(m++):exit(n++);}

Et sinon....

Liste des hello world: http://en.wikipedia.org/wiki/List_of_hello_world_programs

Liste des hello world en langages ésoteriques: http://en.wikipedia.org/wiki/Hello_world_p...teric_languages

Dont mon préféré est le HQ9+:

Quarky · August 2, 2006

Pour l'ancien scientifique que je suis, je trouve le DNA / Genetic code sympa :arrow:

It is possible to treat the standard genetic code as a programming language; the following translates to the peptide HELLQWQRLD.

TACGTACTTAATAATGTTACCGTTGCAAATCTAATC

FiP_ · August 14, 2006

TACGTACTTAATAATGTTACCGTTGCAAATCTAATC

D'accord mais est ce qu'elle existe dans la nature?

De toutes façons, comme disais je ne sais plus qui, quand on aura décrypté tout le génome humain on se rendra compte que les derniers 5% sont les mentions légales et le copyright ^^;

(je crois que ça à été décrypté entierement mais bon. c'etait quand même drole)

Sign In

"Hello World!" dans tous les langages

Recommended Posts

Link to comment

Share on other sites

Top Posters In This Topic

Popular Days

Top Posters In This Topic

Popular Days

Link to comment

Share on other sites

Link to comment

Share on other sites

Link to comment

Share on other sites

Link to comment

Share on other sites

Link to comment

Share on other sites

Link to comment

Share on other sites

Link to comment

Share on other sites

Link to comment

Share on other sites

Link to comment

Share on other sites

Link to comment

Share on other sites

Link to comment

Share on other sites

Link to comment

Share on other sites

Link to comment

Share on other sites

Link to comment

Share on other sites

Link to comment

Share on other sites

Link to comment

Share on other sites

Link to comment

Share on other sites

Link to comment

Share on other sites

Link to comment

Share on other sites

Link to comment

Share on other sites

Link to comment

Share on other sites

Link to comment

Share on other sites

Link to comment

Share on other sites

Link to comment

Share on other sites

Join the conversation