flopasques Posted November 9, 2004 Share Posted November 9, 2004 En Visual J# [J Sharp] MessageBox.Show("Hello World !"); En Visual FoxPro MESSAGEBOX("Hello World !","Hello",36,1) Link to post Share on other sites
an0nyme Posted November 13, 2004 Share Posted November 13, 2004 En xul : <?xml version="1.0" encoding="ISO-8859-1"?> <?xml-stylesheet href="mycss.css" type="text/css"?> <window xmlns="http://www.mozilla.org/keymaster/gatekeeper/there.is.only.xul"> <description>Hello World</description> </window> En wml <?xml version="1.0"?> <!DOCTYPE wml PUBLIC "-//WAPFORUM//DTD WML 1.1//EN" "http://www.wapforum.org/DTD/wml_1.1.xml"> <wml> <card id="card1" title="Hello" > <p>Hello World</p> </card> </wml> Link to post Share on other sites
namewithn0man Posted November 14, 2004 Share Posted November 14, 2004 de 4 manières en SSPL Hello World ! §Hello World ! $r.null Hello World ! $0 Hello World ! (respectivement : en texte normal, en titre, en tag d'histogramme, en tag de nombre) note: le Simple Statistics Presentation Language est mon invention de ce soir même. Je viens de finir une première implémentation qui marche pas mal. Je l'ai crée pour simplifier la saisie d'un template en vue d'une étude de dénombrement. Plus de détails ici Link to post Share on other sites
Arofarn Posted November 29, 2004 Share Posted November 29, 2004 En RPL (normal), HP48GX (façon boite): << CLLDC "Hello World!" MSGBOX 0 FREEZE >> Vais voir à le faire en RPL-system plus tard Link to post Share on other sites
Wooden Posted October 31, 2005 Share Posted October 31, 2005 allez c'est pas un hello world mais c'est un 'hi' qui a le merite d'etre polyglote #define print(x) main(){printf(x);return 0;} /* >+++++[<++>-]<[>++++ # +++<-]>++.+.[-]>+++++[<++>-]<.[-][ # # This polyglot prints "HI" when run in # Brainfuck, C, COW, Perl, Python, Gammaplex, l33t, and ruby # # */ print ("HI\n") #/* # @X"H"Xr X"I"Xr RE # moOMoOMoOMoOMoOMoOMOOmOoMoOMoOmoOMOomoo # mOoMOOmoOMoOMoOMoOMoOMoOMoOMoOmOoMOomoo # moOMoOMoOMooMoOMooMOOMOomoomoOMoOMoOMoO # MoOMoOMOOmOoMoOMoOmoOMOomoomOoMooMOOMOo # moo 5 0 7 99999998 1 7 0 1 8 9999998 1 91 # ] */ © Marinus Oosters Link to post Share on other sites
SooW Posted October 31, 2005 Share Posted October 31, 2005 CAML let = print_endline "Hello world !";; Je vais me permettre une petite correction étant donné que je suis un pro de CAML. Ce n'est pas la bonne syntaxe. Pour preuve, la réponse de CAML est : # let = print_endline "Hello world !";;Characters 4-5: let = print_endline "Hello world !";; ^ Syntax error La bonne syntaxe serait : print_endline "Hello World !" ;; Link to post Share on other sites
neves Posted October 31, 2005 Share Posted October 31, 2005 allez c'est pas un hello world mais c'est un 'hi' qui a le merite d'etre polyglote #define print(x) main(){printf(x);return 0;} /* >+++++[<++>-]<[>++++ # +++<-]>++.+.[-]>+++++[<++>-]<.[-][ # # This polyglot prints "HI" when run in # Brainfuck, C, COW, Perl, Python, Gammaplex, l33t, and ruby # # */ print ("HI\n") #/* # @X"H"Xr X"I"Xr RE # moOMoOMoOMoOMoOMoOMOOmOoMoOMoOmoOMOomoo # mOoMOOmoOMoOMoOMoOMoOMoOMoOMoOmOoMOomoo # moOMoOMoOMooMoOMooMOOMOomoomoOMoOMoOMoO # MoOMoOMOOmOoMoOMoOmoOMOomoomOoMooMOOMOo # moo 5 0 7 99999998 1 7 0 1 8 9999998 1 91 # ] */ © Marinus Oosters Magnifique ! Link to post Share on other sites
kmlz Posted January 3, 2006 Share Posted January 3, 2006 Brainfuck ++++++++++ [ >+++++++>++++++++++>+++>+<<<<- ] >++. >+. +++++++. . +++. >++. <<+++++++++++++++. >. +++. ------. --------. >+. >. Link to post Share on other sites
Eagle1 Posted January 3, 2006 Share Posted January 3, 2006 vous avez oublié le français ----------------------- dire => " bonjour tout le monde " ----------------------- Link to post Share on other sites
tsubasaleguedin Posted June 12, 2006 Share Posted June 12, 2006 En C.A. Clipper/xBase ?"Hello World" ou @SAY 1,1 "Hello World" En xHarbour qout("Hello world") Link to post Share on other sites
Shinuza Posted June 16, 2006 Share Posted June 16, 2006 XML + XSL ainsi que ASP Link to post Share on other sites
theocrite Posted June 17, 2006 Share Posted June 17, 2006 Chui pas bien sûr que tu ai saisi le but du topic. Link to post Share on other sites
Shinuza Posted June 18, 2006 Share Posted June 18, 2006 Chui pas bien sûr que tu ai saisi le but du topic. ASP <html> <head> <title>Hello World</title> </head> <body> <% response.write("Hello World!") %> </body> <html> XML Code de hello.xml <?xml version="1.0" encoding="ISO-8859-1"?> <?xml-stylesheet type="text/xsl" href="hello.xsl" ?> <hello> Hello World! </hello> Code de hello.xsl <?xml version="1.0" encoding="ISO-8859-1"?> <xsl:stylesheet version="1.0" xmlns:xsl="http://www.w3.org/1999/XSL/Transform"> <xsl:template match="/"> <HTML> <HEAD> <TITLE>Hello World</TITLE> </HEAD> <BODY> <xsl:apply-templates/> </BODY> </HTML> </xsl:template > <xsl:template match="hello" > <p> <xsl:value-of select="."/> </p> </xsl:template > </xsl:stylesheet> C'est mieux comme ça? Link to post Share on other sites
mikemowgli Posted July 1, 2006 Share Posted July 1, 2006 il manque le shell de linux/unix non? echo Hello World! tout simplement Link to post Share on other sites
Sentinel Posted July 1, 2006 Share Posted July 1, 2006 en rot180 : plrom ollay (private joke irc inside ) Link to post Share on other sites
tsubasaleguedin Posted July 13, 2006 Share Posted July 13, 2006 en rot180 : plrom ollay (private joke irc inside ) C'est pas un cryptage plutot le rot ? Link to post Share on other sites
theocrite Posted July 13, 2006 Share Posted July 13, 2006 s/cryptage/chiffrement/ Link to post Share on other sites
marque-page Posted July 26, 2006 Share Posted July 26, 2006 En texas instrument TI-83+ : Disp "Hello world !" Et pour poursuivre dans les calculettes, avec une sharp EL-9400 : Print "Hello world !" Link to post Share on other sites
Pattenrond Posted July 29, 2006 Share Posted July 29, 2006 (edited) Chalut en javascript + HTML <html> <body> <script language="javascript"> document.write("Hello World"); </script> </body> </html> on peut aussi faire comme ça <html> <head> <script language="javascript"> function bijour(){ document.write("Hello World");} </script> </head> <body onLoad="bijour()"> </body> </html> Avec Nsis (Installateur de Winamp) Name "Bonjour" OutFile "bonjour.exe" AutoCloseWindow true Section "" MessageBox MB_OK "Hello World" SectionEnd Petite variation Name "Bonjour" OutFile "bonjour2.exe" AutoCloseWindow true Section "" MessageBox MB_OK "Salut PcInpact et vive les poussins !!" SectionEnd Function .onInit MessageBox MB_OK "Hello World" FunctionEnd @pluche Edited July 29, 2006 by Pattenrond Link to post Share on other sites
Pattenrond Posted July 29, 2006 Share Posted July 29, 2006 J'ai ça aussi Le batch @echo off echo Hello World Link to post Share on other sites
theocrite Posted August 2, 2006 Share Posted August 2, 2006 Je doute que personne ne l'ai encore faite celle là. Link to post Share on other sites
Pattenrond Posted August 2, 2006 Share Posted August 2, 2006 Je doute que personne ne l'ai encore faite celle là. tu parles de quoi ? Le batch, j'en ai vu une variante. Le nsis, j'en ai pas vu le javascript, euh, j'en ai pas vu (enfin je crois) Link to post Share on other sites
FiP_ Posted August 2, 2006 Share Posted August 2, 2006 En C: int n[]={0x48, 0x65,0x6C,0x6C, 0x6F,0x2C,0x20, 0x77,0x6F,0x72, 0x6C,0x64,0x21, 0x0A,0x00},*m=n; main(n){putchar (*m)!='\0'?main (m++):exit(n++);} Et sinon.... Liste des hello world: http://en.wikipedia.org/wiki/List_of_hello_world_programs Liste des hello world en langages ésoteriques: http://en.wikipedia.org/wiki/Hello_world_p...teric_languages Dont mon préféré est le HQ9+: H Link to post Share on other sites
Quarky Posted August 2, 2006 Share Posted August 2, 2006 Pour l'ancien scientifique que je suis, je trouve le DNA / Genetic code sympa It is possible to treat the standard genetic code as a programming language; the following translates to the peptide HELLQWQRLD. TACGTACTTAATAATGTTACCGTTGCAAATCTAATC Link to post Share on other sites
FiP_ Posted August 14, 2006 Share Posted August 14, 2006 TACGTACTTAATAATGTTACCGTTGCAAATCTAATC D'accord mais est ce qu'elle existe dans la nature? De toutes façons, comme disais je ne sais plus qui, quand on aura décrypté tout le génome humain on se rendra compte que les derniers 5% sont les mentions légales et le copyright ^^; (je crois que ça à été décrypté entierement mais bon. c'etait quand même drole) Link to post Share on other sites
Recommended Posts
Please sign in to comment
You will be able to leave a comment after signing in
Sign In Now